MirGeneDB

MirGeneDB ID

Rno-Mir-203-v2

Family name MIR-203 (all species)
Seed GAAAUGU
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-203a
Paralogues Rno-Mir-203-v1 
Orthologues Aca-Mir-203-v2  Ami-Mir-203-v2  Bta-Mir-203-v2  Cfa-Mir-203-v2  Cpi-Mir-203-v2  Cpo-Mir-203-v2  Dno-Mir-203-v2  Ete-Mir-203-v2  Gga-Mir-203-v2  Hsa-Mir-203-v2  Mdo-Mir-203-v2  Mml-Mir-203-v2  Mmu-Mir-203-v2  Oan-Mir-203-v2  Sha-Mir-203-v2  Sto-Mir-203-v2  Tgu-Mir-203-v2  Xtr-Mir-203-v2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(rn6)
chr6: 136704974-136705033 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-203-v2)
Mir-203-v1 chr6: 136704974-136705033 [+] UCSC Ensembl
Mir-203-v2 chr6: 136704974-136705033 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGAGCUUCUGUGUGCAGGCGCGCCUGGUCCAGUGGUUCUUAACAGUUCAACAGUUCUGUAGCGCAAUUGUGAAAUGUUUAGGACCACUAGACCCGGCGCGCACGGCAGCGGCGACAGCAA
Get precursor sequence
Structure
        10          20        30        40        50          
AGAGCUUCUGUGUGCAG--|      U    C         U    G    A  GUUCUGU 
                   GCGCGCC GGUC AGUGGUUCU AACA UUCA CA       \
                   CGCGCGG CCAG UCACCAGGA UUGU AAGU GU       A
AACGACAGCGGCGACGGCA^      C    A         U    A    -  UAACGCG 
.       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-203-v2_5p*

MirBase accessionMIMAT0017153
Sequence
0- AGUGGUUCUUAACAGUUCAACA -22
Get sequence
Validated targets TargetScanVert: rno-miR-203a-5p
miRDB: MIMAT0017153
Mature sequence

Rno-Mir-203-v2_3p

MirBase accessionMIMAT0000876
Sequence
39- UGAAAUGUUUAGGACCACUAG -60
Get sequence
Validated targets microrna.org: MIMAT0000876
TargetScanVert: rno-miR-203a-3p
miRDB: MIMAT0000876