MirGeneDB

MirGeneDB ID

Mmu-Mir-143

Family name MIR-143 (all species)
Seed GAGAUGA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-143
Paralogues
Orthologues Aca-Mir-143  Ami-Mir-143  Bta-Mir-143  Cfa-Mir-143  Cli-Mir-143  Cpi-Mir-143  Cpo-Mir-143  Dno-Mir-143  Dre-Mir-143  Ete-Mir-143  Gga-Mir-143  Hsa-Mir-143  Mdo-Mir-143  Mml-Mir-143  Oan-Mir-143  Ocu-Mir-143  Rno-Mir-143  Sha-Mir-143  Sto-Mir-143  Xtr-Mir-143 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr18: 61649199-61649253 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-143)
Mir-145 chr18: 61647829-61647888 [-] UCSC Ensembl
Mir-143 chr18: 61649199-61649253 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGCGUGCGGAGCGCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGGGAGAAGAUGUCCUGCAGCCGUCA
Get precursor sequence
Structure
        10          20        30        40        50       
UGCGUGCGGAGCGCCUG--|     AG      G         G      UGGUCAGU 
                   UCUCCC  CCUGAG UGCAGUGCU CAUCUC        \
                   AGAGGG  GGACUC AUGUCACGA GUAGAG        U
ACUGCCGACGUCCUGUAGA^     AA      G         A      UCUGAGGG 
   110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-143_5p*

MirBase accessionMIMAT0017006
Sequence
0- GGUGCAGUGCUGCAUCUCUGG -21
Get sequence
Validated targets TargetScanVert: mmu-miR-143-5p
miRDB: MIMAT0017006
Mature sequence

Mmu-Mir-143_3p

MirBase accessionMIMAT0000247
Sequence
34- UGAGAUGAAGCACUGUAGCUC -55
Get sequence
Validated targets microrna.org: MIMAT0000247
TargetScanVert: mmu-miR-143-3p
miRDB: MIMAT0000247