MirGeneDB

MirGeneDB ID

Gga-Mir-143

Family name MIR-143 (all species)
Seed GAGAUGA
Species Chicken (Gallus gallus)
MiRBase ID gga-mir-143
Paralogues
Orthologues Aca-Mir-143  Ami-Mir-143  Bta-Mir-143  Cfa-Mir-143  Cli-Mir-143  Cpi-Mir-143  Cpo-Mir-143  Dno-Mir-143  Dre-Mir-143  Ete-Mir-143  Hsa-Mir-143  Mdo-Mir-143  Mml-Mir-143  Mmu-Mir-143  Oan-Mir-143  Ocu-Mir-143  Rno-Mir-143  Sha-Mir-143  Sto-Mir-143  Xtr-Mir-143 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(galGal5)
13: 8493110-8493164 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-143)
Mir-145 13: 8492498-8492557 [-] UCSC Ensembl
Mir-143 13: 8493110-8493164 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUGGGGGCUCCUCCAUGUCUCCCAGCCCAAGGUGCAGUGCUGCAUCUCUGGUCAAUUGGGAGUCUGAGAUGAAGCACUGUAGCUCGGGAAGGGAGGAACUGUGCCCUGGGACCCC
Get precursor sequence
Structure
        10          20        30        40        50       
CUGGGGGCUCCUCCAUG--|     AG   A  G         G      UGGUCAAU 
                   UCUCCC  CCC AG UGCAGUGCU CAUCUC        \
                   GGAGGG  GGG UC AUGUCACGA GUAGAG        U
CCCCAGGGUCCCGUGUCAA^     AA   C  G         A      UCUGAGGG 
   110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsNo
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Star sequence

Gga-Mir-143_5p*

MirBase accessionMIMAT0048645
Sequence
0- GGUGCAGUGCUGCAUCUCUGG -21
Get sequence
Mature sequence

Gga-Mir-143_3p

MirBase accessionMIMAT0048646
Sequence
34- UGAGAUGAAGCACUGUAGCUC -55
Get sequence