MirGeneDB

MirGeneDB ID

Lgi-Mir-1994-P1

Family name MIR-1994 (all species)
Seed GAGACAG
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-1994a
Paralogues Lgi-Mir-1994-P2 
Orthologues Cgi-Mir-1994-P1  Cte-Mir-1994  Efe-Mir-1994 
Node of Origin (locus) Mollusca
Node of Origin (family) Lophotrochozoa
Genome context
(Lotgi1)
LOTGIsca_4: 5290040-5290099 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-1994-P1)
Mir-1994-P1 LOTGIsca_4: 5290040-5290099 [+] Ensembl
Mir-1994-P2 LOTGIsca_4: 5290321-5290377 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AGUAAUACAGCAAACCCAAGUUUUCUCUCAGGGGAAGUCACUCUCGUCUCCAUGCCCCGAUAUCAGCAUGAGACAGUGUGUCCUCCCUUGAGUGAGAUGCUAUAAAGCCGCUAUGUUGCU
Get precursor sequence
Structure
        10         20         30        40        50        60
AGUAAUACAGCAAACCCA-   -|   U         AGU   U  C     C   CCCCG 
                   AGU UUUC CUCAGGGGA   CAC CU GUCUC AUG     A
                   UCG AGAG GAGUUCCCU   GUG GA CAGAG UAC     U
UCGUUGUAUCGCCGAAAUA   U^   U         CCU   U  -     -   GACUA 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
CommentAlthough there are reads of the 3p arm they are short so it is unclear if this is a Group 1 or Group 2 miRNA.
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Lgi-Mir-1994-P1_5p* (predicted)

MirBase accessionNone
Sequence
0- GGGGAAGUCACUCUCGUCUCCAUG -24
Get sequence
Mature sequence

Lgi-Mir-1994-P1_3p

MirBase accessionMIMAT0009724
Sequence
38- UGAGACAGUGUGUCCUCCCUUG -60
Get sequence