MirGeneDB

MirGeneDB ID

Lgi-Mir-1994-P2

Family name MIR-1994 (all species)
Seed GAGACAG
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-1994b
Paralogues Lgi-Mir-1994-P1 
Orthologues Cgi-Mir-1994-P2  Cte-Mir-1994  Efe-Mir-1994 
Node of Origin (locus) Mollusca
Node of Origin (family) Lophotrochozoa
Genome context
(Lotgi1)
LOTGIsca_4: 5290321-5290377 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-1994-P2)
Mir-1994-P1 LOTGIsca_4: 5290040-5290099 [+] Ensembl
Mir-1994-P2 LOTGIsca_4: 5290321-5290377 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GGAAGAGACAUUGAAAUGGCAACUGUUCUCAGGAAGAACAUUCUGUCUACAUGUUACACUAACCAUGAGACAGUGUGUCCUCCCUCAGGCUCAUAUCUUGCCGAAUUCGCCUUCUCU
Get precursor sequence
Structure
        10                 20        30        40        50        
GGAAGAGACAUUGAAAU---------|  AA   UUCUC   A  A    U      A    UUAC 
                          GGC  CUG     AGG AG ACAU CUGUCU CAUG    A
                          UCG  GAC     UCC UC UGUG GACAGA GUAC    C
UCUCUUCCGCUUAAGCCGUUCUAUAC^  --   -----   C  C    U      -    CAAU 
     110       100        90               80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
To
Star sequence

Lgi-Mir-1994-P2_5p* (predicted)

MirBase accessionNone
Sequence
0- AGGAAGAACAUUCUGUCUACAUG -23
Get sequence
Mature sequence

Lgi-Mir-1994-P2_3p

MirBase accessionMIMAT0009725
Sequence
35- UGAGACAGUGUGUCCUCCCUCA -57
Get sequence