MirGeneDB

MirGeneDB ID

Gga-Mir-146-P2

Family name MIR-146 (all species)
Seed GAGAACU
Species Chicken (Gallus gallus)
MiRBase ID gga-mir-146b
Paralogues Gga-Mir-146-P1  Gga-Mir-146-P3 
Orthologues Aca-Mir-146-P2  Ami-Mir-146-P2  Bta-Mir-146-P2  Cfa-Mir-146-P2  Cli-Mir-146-P2  Cpi-Mir-146-P2  Cpo-Mir-146-P2  Dno-Mir-146-P2  Dre-Mir-146-P2  Ete-Mir-146-P2  Hsa-Mir-146-P2  Mdo-Mir-146-P2  Mml-Mir-146-P2  Mmu-Mir-146-P2  Oan-Mir-146-P2  Ocu-Mir-146-P2  Rno-Mir-146-P2  Sha-Mir-146-P2  Tgu-Mir-146-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(galGal5)
6: 23143404-23143464 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGAAGCCAGCGAGGACUGGCUGCUUGGCUUUGAGAACUGAAUUCCAUAGGCGUUAAAGCAUCCAAAAAUGCCCUAUGGAUUCAGUUCUGCAGUUGGGCAGCAAAUAAACCUCCAGCCUUCA
Get precursor sequence
Structure
        10          20        30        40        50         60
GGAAGCCAGCGAGGACUG--|     UG   UUG          U       -    AAAGC 
                    GCUGCU  GCU   AGAACUGAAU CCAUAGG CGUU     A
                    CGACGG  UGA   UCUUGACUUA GGUAUCC GUAA     U
ACUUCCGACCUCCAAAUAAA^     GU   CG-          -       C    AAACC 
 .       110       100        90         80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Mature sequence

Gga-Mir-146-P2_5p

MirBase accessionMIMAT0003351
Sequence
0- UGAGAACUGAAUUCCAUAGGCGUU -24
Get sequence
Validated targets TargetScanVert: gga-miR-146b-5p
miRDB: MIMAT0003351
Star sequence

Gga-Mir-146-P2_3p*

MirBase accessionMIMAT0003724
Sequence
38- UGCCCUAUGGAUUCAGUUCUGCA -61
Get sequence
Validated targets TargetScanVert: gga-miR-146b-3p
miRDB: MIMAT0003724