MirGeneDB

MirGeneDB ID

Aca-Mir-146-P2

Family name MIR-146 (all species)
Seed GAGAACU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-146a
Paralogues Aca-Mir-146-P3 
Orthologues Ami-Mir-146-P2  Bta-Mir-146-P2  Cfa-Mir-146-P2  Cli-Mir-146-P2  Cpi-Mir-146-P2  Cpo-Mir-146-P2  Dno-Mir-146-P2  Dre-Mir-146-P2  Ete-Mir-146-P2  Gga-Mir-146-P2  Hsa-Mir-146-P2  Mdo-Mir-146-P2  Mml-Mir-146-P2  Mmu-Mir-146-P2  Oan-Mir-146-P2  Ocu-Mir-146-P2  Rno-Mir-146-P2  Sha-Mir-146-P2  Tgu-Mir-146-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
3: 39596510-39596569 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGGGAGGAGACCUACAUGGUUGCCUAGCUCUGAGAACUGAAUUCCAUAGGCUUUAGAAUAAUUGAAACGCCCCGUGGAUUCAGUUCUACAGCUAGGCAGCAACUAAACUCCAGAAUGCUG
Get precursor sequence
Structure
        10          20        30        40         50          
CGGGAGGAGACCUACAUG--|          CUG          U    A-   UUUAGAAU 
                    GUUGCCUAGCU   AGAACUGAAU CCAU  GGC        \
                    CGACGGAUCGA   UCUUGACUUA GGUG  CCG        A
GUCGUAAGACCUCAAAUCAA^          CA-          -    CC   CAAAGUUA 
.       110       100        90         80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-146-P2_5p

MirBase accessionMIMAT0021775
Sequence
0- UGAGAACUGAAUUCCAUAGGCUUU -24
Get sequence
Star sequence

Aca-Mir-146-P2_3p*

MirBase accessionMIMAT0021776
Sequence
38- GCCCCGUGGAUUCAGUUCUACA -60
Get sequence