MirGeneDB

MirGeneDB ID

Dno-Mir-124-P1-v2

Family name MIR-124 (all species)
Seed UAAGGCA
Species Nine-banded armadillo (Dasypus novemcinctus)
MiRBase ID
Paralogues Dno-Mir-124-P1-v1  Dno-Mir-124-P2-v1  Dno-Mir-124-P2-v2  Dno-Mir-124-P3-v1  Dno-Mir-124-P3-v2 
Orthologues Aae-Mir-124  Aca-Mir-124-P1-v1  Aca-Mir-124-P1-v2  Ami-Mir-124-P1-v1  Ami-Mir-124-P1-v2  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Bta-Mir-124-P1-v1  Bta-Mir-124-P1-v2  Cel-Mir-124  Cfa-Mir-124-P1-v1  Cfa-Mir-124-P1-v2  Cpi-Mir-124-P1-v1  Cpi-Mir-124-P1-v2  Cpo-Mir-124-P1-v1  Cpo-Mir-124-P1-v2  Cte-Mir-124  Dan-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dpu-Mir-124  Dre-Mir-124-P1-v1  Dre-Mir-124-P1-v2  Ete-Mir-124-P1-v1  Ete-Mir-124-P1-v2  Gga-Mir-124-P1-v1  Gga-Mir-124-P1-v2  Hme-Mir-124  Hsa-Mir-124-P1-v1  Hsa-Mir-124-P1-v2  Isc-Mir-124  Lan-Mir-124  Mdo-Mir-124-P1-v1  Mdo-Mir-124-P1-v2  Mml-Mir-124-P1-v1  Mml-Mir-124-P1-v2  Mmu-Mir-124-P1-v1  Mmu-Mir-124-P1-v2  Ocu-Mir-124-P1-v1  Ocu-Mir-124-P1-v2  Pfl-Mir-124  Pmi-Mir-124  Rno-Mir-124-P1-v1  Rno-Mir-124-P1-v2  Sha-Mir-124-P1-v1  Sha-Mir-124-P1-v2  Sko-Mir-124  Spu-Mir-124  Sto-Mir-124-P1-v1  Sto-Mir-124-P1-v2  Tca-Mir-124  Tgu-Mir-124-P1-v1  Tgu-Mir-124-P1-v2  Xtr-Mir-124-P1-v1  Xtr-Mir-124-P1-v2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(dasNov3)
1812924288_name_238801685_mate_1812919966: 586-645 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCCUUCCUCAGGAGAAAAGGCUCCUGUCUCUGUGUUCACAGCGGACCUUGAUUUAAAUGUCCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAUCGGGACCGGCCGAGCACCGUUACCGC
Get precursor sequence
Structure
        10         20         30        40        50          
CCCUUCCUCAGGAGAAAA-| C     -   CU        A   GA        UAAAUG 
                   GG UCCUG UCU  GUGUUCAC GCG  CCUUGAUU      \
                   CC AGGGC AGA  CGUAAGUG CGC  GGAAUUAA      U
CGCCAUUGCCACGAGCCGG^ -     U   AC        G   AC        CAUACC 
.       110       100         90        80        70
Deep sequencing
Go to detailed chart
CommentNot in assembly but in trace archive.
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Dno-Mir-124-P1-v2_5p*

MirBase accessionNone
Sequence
0- UGUGUUCACAGCGGACCUUGAUU -23
Get sequence
Mature sequence

Dno-Mir-124-P1-v2_3p

MirBase accessionNone
Sequence
38- UUAAGGCACGCGGUGAAUGCCA -60
Get sequence