MirGeneDB

MirGeneDB ID

Dan-Mir-305

Family name MIR-305 (all species)
Seed UUGUACU
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-305
Paralogues
Orthologues Aae-Mir-305  Asu-Mir-305  Bge-Mir-305  Cbr-Mir-305-P1  Cbr-Mir-305-P2  Cbr-Mir-305-P3  Cel-Mir-305-P1  Cel-Mir-305-P2  Dme-Mir-305  Dmo-Mir-305  Dpu-Mir-305  Hme-Mir-305  Isc-Mir-305  Tca-Mir-305 
Node of Origin (locus) Ecdysozoa
Node of Origin (family) Ecdysozoa
Genome context
(Dana_caf1)
scaffold_12916: 15334171-15334231 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-305)
Mir-275 scaffold_12916: 15334009-15334068 [+] Ensembl
Mir-305 scaffold_12916: 15334171-15334231 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GUAUUUUUGAGAAAUAUGUCUCCCAUGUCUAUUGUACUUCAUCAGGUGCUCUGGUGUCCACCGUAACCCGGCACAUGUUGAAGUACACUCAAUAUGAGGCGAAUGUCAAACGAAGAGUUCU
Get precursor sequence
Structure
        10         20         30        40        50        60
GUAUUUUUGAGAAAUAUG-  U  -|    CUAU         U  G     CU  UGUCC 
                   UC CC CAUGU    UGUACUUCA CA GUGCU  GG     A
                   AG GG GUAUA    ACAUGAAGU GU CACGG  CC     C
UCUUGAGAAGCAAACUGUA  C  A^    ACUC         U  A     C-  AAUGC 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), UGUG in loop
Tissue expression
 +
Da
Mature sequence

Dan-Mir-305_5p

MirBase accessionMIMAT0008464
Sequence
0- AUUGUACUUCAUCAGGUGCUCUGG -24
Get sequence
Star sequence

Dan-Mir-305_3p*

MirBase accessionNone
Sequence
38- CGGCACAUGUUGAAGUACACUCA -61
Get sequence