MirGeneDB

MirGeneDB ID

Dan-Mir-275

Family name MIR-275 (all species)
Seed CAGGUAC
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-275
Paralogues
Orthologues Aae-Mir-275  Bge-Mir-275  Dme-Mir-275  Dmo-Mir-275  Dpu-Mir-275  Hme-Mir-275  Isc-Mir-275  Tca-Mir-275 
Node of Origin (locus) Arthropoda
Node of Origin (family) Arthropoda
Genome context
(Dana_caf1)
scaffold_12916: 15334009-15334068 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-275)
Mir-275 scaffold_12916: 15334009-15334068 [+] Ensembl
Mir-305 scaffold_12916: 15334171-15334231 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AAGUCCAGCACUCUCCAGUCUCCUACCUUGCGCGCUAAUCAGUGACCGGGGCUGGUUUUUGCAACAGUCAGGUACCUGAAGUAGCGCGCGUGGUGGCAGACAUAUAUCCGCCAUACAAAA
Get precursor sequence
Structure
        10          20        30         40        50         
AAGUCCAGCACUCUCCA--    C     U         A-|   UG   GG    GGUUU 
                   GUCU CUACC UGCGCGCUA  UCAG  ACC  GGCU     U
                   CAGA GGUGG GCGCGCGAU  AGUC  UGG  CUGA     U
AAAACAUACCGCCUAUAUA    C     U         GA^   CA   A-    CAACG 
.       110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-275_5p*

MirBase accessionNone
Sequence
0- CGCGCUAAUCAGUGACCGGGGCU -23
Get sequence
Mature sequence

Dan-Mir-275_3p

MirBase accessionMIMAT0008451
Sequence
37- UCAGGUACCUGAAGUAGCGCGCG -60
Get sequence