MirGeneDB

MirGeneDB ID

Cli-Mir-460-P2

Family name MIR-460 (all species)
Seed CCUCAUU
Species Rock pigeon (Columba livia)
MiRBase ID
Paralogues Cli-Mir-460-P1 
Orthologues Aca-Mir-460-P2  Ami-Mir-460-P2  Cpi-Mir-460-P2  Dre-Mir-460-P2  Gga-Mir-460-P2  Tgu-Mir-460-P2  Xtr-Mir-460-P2 
Node of Origin (locus) Osteichthyes
Node of Origin (family) Osteichthyes
Genome context
(colLiv2)
scaffold72: 1902296-1902352 [+]
Precursor
(pre-Mir +30nt flank)
UUGUGACCUCUCUGCUCUGGCUCUAUAGUGUCCUCAUUGUACAUGCUGUGUGUAUUUGUCACGUACACAGCGCAUGCAAUGUGGACAUAAUGGAGCUCAAUUUACACCUGAUAAGGA
Get precursor sequence
Structure
        10          20        30        40        50        
UUGUGACCUCUCUGCUC-  -|      A      U       CA        GUAUUU 
                  UG GCUCUAU GUGUCC CAUUGUA  UGCUGUGU      \
                  AC CGAGGUA UACAGG GUAACGU  GCGACACA      G
AGGAAUAGUCCACAUUUA  U^      A      U       AC        UGCACU 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentThere is a range of Dicer sites ranging from -1 to +4 relative to what is annotated here but this represents the highest mature form across vertebrates.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cli-Mir-460-P2_5p

MirBase accessionNone
Sequence
0- UCCUCAUUGUACAUGCUGUGU -21
Get sequence
Co-mature sequence

Cli-Mir-460-P2_3p

MirBase accessionNone
Sequence
36- ACAGCGCAUGCAAUGUGGACA -57
Get sequence