MirGeneDB

MirGeneDB ID

Cli-Mir-205-P2

Family name MIR-205 (all species)
Seed CCUUCAU
Species Rock pigeon (Columba livia)
MiRBase ID
Paralogues Cli-Mir-205-P1 
Orthologues Aca-Mir-205-P2  Ami-Mir-205-P2  Cpi-Mir-205-P2  Gga-Mir-205-P2  Sto-Mir-205-P2  Tgu-Mir-205-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold121: 707087-707145 [+]
Precursor
(pre-Mir +30nt flank)
AGGUACAGCAGCCUCAGGGCCUUCUUGGCACCCUUCAUUCCACCGGAAUCUGUCUAUACAGAAACCAGAUUUCAGUGAAAUGAAGCCUGUCAGAGAGGCAGGUCAUCCCCCACCUCAGC
Get precursor sequence
Structure
        10          20        30        40        50         
AGGUACAGCAGCCUCAGG--|   UC      CC       C   C        UCUAUA 
                    GCCU  UUGGCA  CUUCAUU CAC GGAAUCUG      \
                    CGGA  GACUGU  GAAGUAA GUG CUUUAGAC      C
CGACUCCACCCCCUACUGGA^   GA      CC       A   A        CAAAGA 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cli-Mir-205-P2_5p

MirBase accessionNone
Sequence
0- CCCUUCAUUCCACCGGAAUCUG -22
Get sequence
Star sequence

Cli-Mir-205-P2_3p*

MirBase accessionNone
Sequence
37- GAUUUCAGUGAAAUGAAGCCUG -59
Get sequence