MirGeneDB

MirGeneDB ID

Cpi-Mir-205-P2

Family name MIR-205 (all species)
Seed CCUUCAU
Species Western painted turtle (Chrysemys picta bellii)
MiRBase ID cpi-mir-205b
Paralogues Cpi-Mir-205-P1 
Orthologues Aca-Mir-205-P2  Ami-Mir-205-P2  Cli-Mir-205-P2  Gga-Mir-205-P2  Sto-Mir-205-P2  Tgu-Mir-205-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(chrPic1)
JH584592: 638160-638218 [+] UCSC
Precursor
(pre-Mir +30nt flank)
GAGGCCACCCCAGUCCAUGGCUUGCUGGUGCCCUUCAUUCCACCGGAAUCUGUAGAGGCAGAAACCAGAUUUCAGUGUAAUGAAGCCCAUCAGACAUGGAAUUCAACUCCUCACCUUCG
Get precursor sequence
Structure
        10        20          30        40        50         
GAGGCCACCCCAGUCCAUGGCU-  -|     CC       C   C        UAGAGG 
                       UG CUGGUG  CUUCAUU CAC GGAAUCUG      \
                       AC GACUAC  GAAGUAA GUG CUUUAGAC      C
GCUUCCACUCCUCAACUUAAGGU  A^     CC       U   A        CAAAGA 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
Te Te Te To
Mature sequence

Cpi-Mir-205-P2_5p

MirBase accessionMIMAT0037832
Sequence
0- CCCUUCAUUCCACCGGAAUCUG -22
Get sequence
Star sequence

Cpi-Mir-205-P2_3p* (predicted)

MirBase accessionNone
Sequence
37- GAUUUCAGUGUAAUGAAGCCCA -59
Get sequence