MirGeneDB

MirGeneDB ID

Sto-Mir-205-P2

Family name MIR-205 (all species)
Seed CCUUCAU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-205-P1  Sto-Mir-205-P3 
Orthologues Aca-Mir-205-P2  Ami-Mir-205-P2  Cli-Mir-205-P2  Cpi-Mir-205-P2  Gga-Mir-205-P2  Tgu-Mir-205-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01054426.1: 1748-1806 [-]
Precursor
(pre-Mir +30nt flank)
AACAAGGUUUCCUCUCCGUGCUUUCUGAUGACCUUCAUUCCACCAGAAUCUGUAGUGAAUACAUCCGGAUUUGAGUGAAAUGGAGAACAUUAAGACAUGGGAUCCAACGAGUGAGAAGA
Get precursor sequence
Structure
        10            20         30        40        50         
AACAAGGUUUCCUCUCC----   -| UUC     AC       C   CA      GUAGUGA 
                     GUG CU   UGAUG  CUUCAUU CAC  GAAUCU       \
                     UAC GA   AUUAC  GAGGUAA GUG  UUUAGG       A
AGAAGAGUGAGCAACCUAGGG   A^ ---     AA       A   AG      CCUACAU 
       110       100           90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Sto-Mir-205-P2_5p

MirBase accessionNone
Sequence
0- ACCUUCAUUCCACCAGAAUCU -21
Get sequence
Star sequence

Sto-Mir-205-P2_3p*

MirBase accessionNone
Sequence
38- AUUUGAGUGAAAUGGAGAACA -59
Get sequence