MirGeneDB

MirGeneDB ID

Sto-Mir-205-P1

Family name MIR-205 (all species)
Seed CCUUCAU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-205-P2  Sto-Mir-205-P3 
Orthologues Aca-Mir-205-P1  Ami-Mir-205-P1  Bta-Mir-205-P1  Cfa-Mir-205-P1  Cli-Mir-205-P1  Cpi-Mir-205-P1  Cpo-Mir-205-P1  Dno-Mir-205-P1  Dre-Mir-205-P1  Ete-Mir-205-P1  Gga-Mir-205-P1  Hsa-Mir-205-P1  Mdo-Mir-205-P1  Mml-Mir-205-P1  Mmu-Mir-205-P1  Oan-Mir-205-P1  Ocu-Mir-205-P1  Rno-Mir-205-P1  Sha-Mir-205-P1  Tgu-Mir-205-P1a  Tgu-Mir-205-P1b  Xtr-Mir-205-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01000299.1: 865493-865551 [+]
Precursor
(pre-Mir +30nt flank)
CCUUAAUGACAUAAUCCAUGCAUUCUGCUGUCCUUCAUUCCACCGGAGUCUGUAACAUAACCAAUCAGAUUUCAGUGGUGUGAAGUGCAGGAGACAUGGAACACAAUCUUCCAAUCAAC
Get precursor sequence
Structure
        10        20          30        40        50         
CCUUAAUGACAUAAUCCAUG-   -|  G   UC      U    C        UAACAU 
                     CAU UCU CUG  CUUCAU CCAC GGAGUCUG      \
                     GUA AGA GAC  GAAGUG GGUG CUUUAGAC      A
CAACUAACCUUCUAACACAAG   C^  G   GU      U    A        UAACCA 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsNo
Tissue expression
 +
To
Mature sequence

Sto-Mir-205-P1_5p

MirBase accessionNone
Sequence
0- UCCUUCAUUCCACCGGAGUCUG -22
Get sequence
Star sequence

Sto-Mir-205-P1_3p* (predicted)

MirBase accessionNone
Sequence
37- GAUUUCAGUGGUGUGAAGUGCA -59
Get sequence