MirGeneDB

MirGeneDB ID

Xtr-Mir-205-P1

Family name MIR-205 (all species)
Seed CCUUCAU
Species Tropical clawed frog (Xenopus tropicalis)
MiRBase ID xtr-mir-205a
Paralogues Xtr-Mir-205-P3 
Orthologues Aca-Mir-205-P1  Ami-Mir-205-P1  Bta-Mir-205-P1  Cfa-Mir-205-P1  Cli-Mir-205-P1  Cpi-Mir-205-P1  Cpo-Mir-205-P1  Dno-Mir-205-P1  Dre-Mir-205-P1  Ete-Mir-205-P1  Gga-Mir-205-P1  Hsa-Mir-205-P1  Mdo-Mir-205-P1  Mml-Mir-205-P1  Mmu-Mir-205-P1  Oan-Mir-205-P1  Ocu-Mir-205-P1  Rno-Mir-205-P1  Sha-Mir-205-P1  Sto-Mir-205-P1  Tgu-Mir-205-P1a  Tgu-Mir-205-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(xenTro7)
KB021657: 76357827-76357885 [+] UCSC
Precursor
(pre-Mir +30nt flank)
CGGUAAAAGAACGAUCCACGUGUCCUGCUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACAUAAUCAGAUUUCAGUGGAGUGAAGCACAAGAGGCAUGUAGCAGUCUCAGCACAACCUG
Get precursor sequence
Structure
        10           20        30        40        50         
CGGUAAAAGAACGAUCC---|    U   GC   C           C        UCUCAU 
                    ACGUG CCU  UGU CUUCAUUCCAC GGAGUCUG      \
                    UGUAC GGA  ACA GAAGUGAGGUG CUUUAGAC      A
GUCCAACACGACUCUGACGA^    -   GA   C           A        UAAUAC 
       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsNo
Tissue expression
 +
Br Em Em Em Em He
Mature sequence

Xtr-Mir-205-P1_5p

MirBase accessionMIMAT0003697
Sequence
0- UCCUUCAUUCCACCGGAGUCUG -22
Get sequence
Validated targets TargetScanVert: xtr-miR-205a
Star sequence

Xtr-Mir-205-P1_3p*

MirBase accessionNone
Sequence
37- GAUUUCAGUGGAGUGAAGCACA -59
Get sequence