MirGeneDB

MirGeneDB ID

Ami-Mir-205-P2

Family name MIR-205 (all species)
Seed CCUUCAU
Species American alligator (Alligator mississippiensis)
MiRBase ID ami-mir-205b
Paralogues Ami-Mir-205-P1 
Orthologues Aca-Mir-205-P2  Cli-Mir-205-P2  Cpi-Mir-205-P2  Gga-Mir-205-P2  Sto-Mir-205-P2  Tgu-Mir-205-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(allMis1)
JH733344: 19647-19705 [+] UCSC
Precursor
(pre-Mir +30nt flank)
AAGGUGACUGUGGUCCAUGGCUUUCUGGUGCCCUUCAUUCCACCGGAAUCUGUAGGGAUCAAAACCAGAUUUCAGUGAAAUGAAGCCCCUCAGACGUGGAAUUCAACCCCUGGCUUUUU
Get precursor sequence
Structure
        10        20          30        40        50         
AAGGUGACUGUGGUCCAUGGCUU--|    UGCC       C   C        UAGGGA 
                         UCUGG    CUUCAUU CAC GGAAUCUG      \
                         AGACU    GAAGUAA GUG CUUUAGAC      U
UUUUUCGGUCCCCAACUUAAGGUGC^    CCCC       A   A        CAAAAC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Ami-Mir-205-P2_5p

MirBase accessionMIMAT0038230
Sequence
0- CCCUUCAUUCCACCGGAAUCUG -22
Get sequence
Star sequence

Ami-Mir-205-P2_3p* (predicted)

MirBase accessionNone
Sequence
37- GAUUUCAGUGAAAUGAAGCCCC -59
Get sequence