MirGeneDB

MirGeneDB ID

Tgu-Mir-205-P2

Family name MIR-205 (all species)
Seed CCUUCAU
Species Zebra finch (Taeniopygia guttata)
MiRBase ID tgu-mir-205
Paralogues Tgu-Mir-205-P1a  Tgu-Mir-205-P1b 
Orthologues Aca-Mir-205-P2  Ami-Mir-205-P2  Cli-Mir-205-P2  Cpi-Mir-205-P2  Gga-Mir-205-P2  Sto-Mir-205-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(taeGut3.2.4)
1A: 622289-622347 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCCGGAGAGGCCAUCGGAGCCUUCCUGGUGCCCUUCAUUCCACCGGAAUCUGUCGAUGCAGAACCCGGAUUUCAGUGAAAUGAAGCCCCUCAGAAAGGCAGGUCAGCCCCACCUCAGCA
Get precursor sequence
Structure
        10          20        30        40        50         
GCCGGAGAGGCCAUCGGA--|    C    UGCC       C   C        UCGAUG 
                    GCCUU CUGG    CUUCAUU CAC GGAAUCUG      \
                    CGGAA GACU    GAAGUAA GUG CUUUAGGC      C
ACGACUCCACCCCGACUGGA^    A    CCCC       A   A        CCAAGA 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Mature sequence

Tgu-Mir-205-P2_5p

MirBase accessionMIMAT0014616
Sequence
0- CCCUUCAUUCCACCGGAAUCUGU -23
Get sequence
Star sequence

Tgu-Mir-205-P2_3p*

MirBase accessionNone
Sequence
36- GGAUUUCAGUGAAAUGAAGCCCC -59
Get sequence