MirGeneDB

MirGeneDB ID

Aca-Mir-205-P2

Family name MIR-205 (all species)
Seed CCUUCAU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-205b
Paralogues Aca-Mir-205-P1 
Orthologues Ami-Mir-205-P2  Cli-Mir-205-P2  Cpi-Mir-205-P2  Gga-Mir-205-P2  Sto-Mir-205-P2  Tgu-Mir-205-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
5: 3605657-3605715 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACAUCUAGCCACAGAUCCAGAGCUUGGGUGCCCUUCAUUCCACCGGAAUCUGUCACCGCAAAAACCGGAUUUCUGUGAAAUGAAGCCCACCAGGCAUGGAAUUCUUCUUCUUUUGGAAC
Get precursor sequence
Structure
        10            20        30        40        50         
ACAUCUAGCCACAGAUC----| GA      G  CC       C   C        UCACCG 
                     CA  GCUUGG UG  CUUCAUU CAC GGAAUCUG      \
                     GU  CGGACC AC  GAAGUAA GUG CUUUAGGC      C
CAAGGUUUUCUUCUUCUUAAG^ A-      -  CC       A   U        CAAAAA 
       110       100         90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-205-P2_5p

MirBase accessionMIMAT0021856
Sequence
0- CCCUUCAUUCCACCGGAAUCUG -22
Get sequence
Star sequence

Aca-Mir-205-P2_3p*

MirBase accessionNone
Sequence
37- GAUUUCUGUGAAAUGAAGCCCA -59
Get sequence