MirGeneDB

MirGeneDB ID

Bta-Mir-101-P2-v2

Family name MIR-101 (all species)
Seed ACAGUAC
Species Cow (Bos taurus)
MiRBase ID bta-mir-101-2
Paralogues Bta-Mir-101-P1-v1  Bta-Mir-101-P1-v2  Bta-Mir-101-P2-v1 
Orthologues Aca-Mir-101-P2-v1  Aca-Mir-101-P2-v2  Ami-Mir-101-P2-v1  Ami-Mir-101-P2-v2  Cfa-Mir-101-P2-v1  Cfa-Mir-101-P2-v2  Cli-Mir-101-P2-v1  Cli-Mir-101-P2-v2  Cpi-Mir-101-P2-v1  Cpi-Mir-101-P2-v2  Cpo-Mir-101-P2-v1  Cpo-Mir-101-P2-v2  Dno-Mir-101-P2-v1  Dno-Mir-101-P2-v2  Dre-Mir-101-P2-v1  Dre-Mir-101-P2-v2  Ete-Mir-101-P2-v1  Ete-Mir-101-P2-v2  Gga-Mir-101-P2-v1  Gga-Mir-101-P2-v2  Hsa-Mir-101-P2-v1  Hsa-Mir-101-P2-v2  Mdo-Mir-101-P2-v1  Mdo-Mir-101-P2-v2  Mml-Mir-101-P2-v1  Mml-Mir-101-P2-v2  Mmu-Mir-101-P2-v1  Mmu-Mir-101-P2-v2  Oan-Mir-101-P2-v1  Oan-Mir-101-P2-v2  Ocu-Mir-101-P2-v1  Ocu-Mir-101-P2-v2  Rno-Mir-101-P2-v1  Rno-Mir-101-P2-v2  Sha-Mir-101-P2-v1  Sha-Mir-101-P2-v2  Sto-Mir-101-P2-v1  Sto-Mir-101-P2-v2  Tgu-Mir-101-P2-v1  Tgu-Mir-101-P2-v2  Xtr-Mir-101-P2-v1  Xtr-Mir-101-P2-v2 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(bosTau8)
chr8: 39940841-39940899 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-101-P2-v2)
Mir-101-P2-v2 chr8: 39940841-39940899 [-] UCSC Ensembl
Mir-101-P2-v1 chr8: 39940842-39940898 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAGGUAGAUAUGAGACUGAACUGUCCUUUUUCGGUUAUCAUGGUACCGAUGCUGUAUAUCUGAAAGGUACAGUACUGUGAUAACUGAAGAAUGGUGGUGCCAUCACAUUGAGAAAGGCU
Get precursor sequence
Structure
        10          20        30        40        50         
CAGGUAGAUAUGAGACUGA--| UG  C                    CGA    GUAUA 
                     AC  UC UUUUUCGGUUAUCAUGGUAC   UGCU     U
                     UG  GG AAGAAGUCAAUAGUGUCAUG   AUGG     C
UCGGAAAGAGUUACACUACCG^ GU  U                    AC-    AAAGU 
       110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-101-P2-v2_5p*

MirBase accessionNone
Sequence
0- UCGGUUAUCAUGGUACCGAUGCU -23
Get sequence
Mature sequence

Bta-Mir-101-P2-v2_3p

MirBase accessionMIMAT0003520
Sequence
37- UACAGUACUGUGAUAACUGAAG -59
Get sequence
Validated targets TargetScanVert: bta-miR-101