MirGeneDB 3.0
MirGeneDB ID

Rno-Mir-145

Family name MIR-145 (all species)
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-145
Paralogues
Orthologues Aca-Mir-145  Ami-Mir-145  Bta-Mir-145  Cfa-Mir-145  Cja-Mir-145  Cli-Mir-145  Cmi-Mir-145  Cpi-Mir-145  Cpo-Mir-145  Dno-Mir-145  Dre-Mir-145  Ebu-Mir-145  Eca-Mir-145  Ete-Mir-145  Gga-Mir-145  Gja-Mir-145  Gmo-Mir-145  Hsa-Mir-145  Laf-Mir-145  Lch-Mir-145  Loc-Mir-145  Mal-Mir-145  Mdo-Mir-145  Mml-Mir-145  Mmr-Mir-145  Mmu-Mir-145  Mun-Mir-145  Neu-Mir-145  Oan-Mir-145  Ocu-Mir-145  Pab-Mir-145  Pbv-Mir-145  Pma-Mir-145  Sha-Mir-145  Spt-Mir-145  Sto-Mir-145  Tgu-Mir-145  Xla-Mir-145-P1  Xla-Mir-145-P2  Xtr-Mir-145 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(rn6)		 chr18: 56969920-56969979 [-] UCSC Ensembl
Clustered miRNAs
(< 50kb from Mir-145)		 Mir-145 chr18: 56969920-56969979 [-] UCSC Ensembl
Mir-143 chr18: 56971298-56971352 [-] UCSC Ensembl
Seed UCCAGUU
Precursor
(pre-Mir +30nt flank)		 
AAGGCAUCUCUCUCCCACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUGGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGCUUAACAGCUGGAUCUGCC
Get precursor sequence
Structure
        10          20        30        40        50          
AAGGCAUCUCUCUCCCA--| U  U     C  UC    U  C            UGGAUG 
                   CC UG CCUCA GG  CAGU UU CCAGGAAUCCCU      \
                   GG AC GGAGU UC  GUCA AA GGUCCUUAGGGG      C
CCGUCUAGGUCGACAAUUC^ U  U     -  UU    U  A            UAGAAU 
.       110       100         90        80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer cut -2 on both arms. Although there is a templated T at the 3' end of the 3p arm, this transcript is annotated as a Group 2 miRNA given the CAGE data in human and the 5' starting cut of 3' offset reads in various vertebrate taxa.
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
- +
Dr Dr Ad Bi Bi Bi Bi Br Br Br Br Ce Ce Ce Ce Co Co Co Co Du Du Du Du Fa He He He Hi Hi Il Il Je Je Ki Ki Ki Ki Ki La Li Li Li Li Li Li Lu Me Me Mu Ov Pa Pa Pa Sk Sm So So So So Sp St St St St Te Te Th Ut Wh
Mature sequence

Rno-Mir-145_5p
mirBase accessionMIMAT0000851
Sequence 
0- GUCCAGUUUUCCCAGGAAUCCCU -23
Get sequence
Proposed targets microrna.org: MIMAT0000851
TargetScanVert: rno-miR-145-5p
miRDB: MIMAT0000851
Star sequence

Rno-Mir-145_3p*
mirBase accessionMIMAT0017131
Sequence 
38- GGAUUCCUGGAAAUACUGUUCU -60
Get sequence
Proposed targets TargetScanVert: rno-miR-145-3p
miRDB: MIMAT0017131