| MirGeneDB ID | Ocu-Mir-145 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-145 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Rabbit (Oryctolagus cuniculus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | ocu-mir-145 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-145 Ami-Mir-145 Bta-Mir-145 Cfa-Mir-145 Cja-Mir-145 Cli-Mir-145 Cmi-Mir-145 Cpi-Mir-145 Cpo-Mir-145 Dno-Mir-145 Dre-Mir-145 Ebu-Mir-145 Eca-Mir-145 Ete-Mir-145 Gga-Mir-145 Gja-Mir-145 Gmo-Mir-145 Hsa-Mir-145 Laf-Mir-145 Lch-Mir-145 Loc-Mir-145 Mal-Mir-145 Mdo-Mir-145 Mml-Mir-145 Mmr-Mir-145 Mmu-Mir-145 Mun-Mir-145 Neu-Mir-145 Oan-Mir-145 Pab-Mir-145 Pbv-Mir-145 Pma-Mir-145 Rno-Mir-145 Sha-Mir-145 Spt-Mir-145 Sto-Mir-145 Tgu-Mir-145 Xla-Mir-145-P1 Xla-Mir-145-P2 Xtr-Mir-145 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (oryCun2_add) |
chr3: 31259937-31259996 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-145) |
Mir-143
chr3: 31258615-31258669 [+]
UCSC
Ensembl
Mir-145 chr3: 31259937-31259996 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UCCAGUU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
ACGGCCACGCUUGCCCACCUUGUCCUCGGGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUUUCACAGCUGGCCCAGCGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 ACGGCCACGCUUGCCCA--| U U UC U C UAGAUG CC UG CCUCGGGG CAGU UU CCAGGAAUCCCU \ GG AC GGAGUUCU GUCA AA GGUCCUUAGGGG C GCGACCCGGUCGACACUUU^ U U U- U A UAGAAU . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Dicer cut -2 on both arms. Although there is a templated T at the 3' end of the 3p arm, this transcript is annotated as a Group 2 miRNA given the CAGE data in human and the 5' starting cut of 3' offset reads in various vertebrate taxa. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ocu-Mir-145_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0048251 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GUCCAGUUUUCCCAGGAAUCCCU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ocu-Mir-145_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0048252 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- GGAUUCCUGGAAAUACUGUUCU -60
Get sequence
|
