MirGeneDB

MirGeneDB ID

Sto-Mir-145

Family name MIR-145 (all species)
Seed UCCAGUU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues
Orthologues Aca-Mir-145  Ami-Mir-145  Bta-Mir-145  Cfa-Mir-145  Cli-Mir-145  Cpi-Mir-145  Cpo-Mir-145  Dno-Mir-145  Dre-Mir-145  Ete-Mir-145  Gga-Mir-145  Hsa-Mir-145  Mdo-Mir-145  Mml-Mir-145  Mmu-Mir-145  Oan-Mir-145  Ocu-Mir-145  Rno-Mir-145  Sha-Mir-145  Xtr-Mir-145 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01000077.1: 1270660-1270719 [+]
Precursor
(pre-Mir +30nt flank)
UUCCGAUCUUCCACUGACCUUCUUCUCAGGGUCCAGUUUUCCCAGGAAUCCCUUCUGUACUGAUAAGGGGAUUCCUGGAAAUACUGUUCUUGGGGGCAAGGCUUGGCAGCUGUUUAAUAA
Get precursor sequence
Structure
        10          20        30        40        50          
UUCCGAUCUUCCACUGA--|   C         UC    U  C            UCUGUA 
                   CCUU UUCUCAGGG  CAGU UU CCAGGAAUCCCU      \
                   GGAA GGGGGUUCU  GUCA AA GGUCCUUAGGGG      C
AAUAAUUUGUCGACGGUUC^   C         U-    U  A            AAUAGU 
.       110       100        90         80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site -2 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Sto-Mir-145_5p

MirBase accessionNone
Sequence
0- GUCCAGUUUUCCCAGGAAUCCCU -23
Get sequence
Star sequence

Sto-Mir-145_3p*

MirBase accessionNone
Sequence
38- GGAUUCCUGGAAAUACUGUUCU -60
Get sequence