| MirGeneDB ID | Llo-Mir-2-o115 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Bootlace worm (Lineus longissimus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Llo-Mir-2-o114-v1 Llo-Mir-2-o116 Llo-Mir-2-o117 Llo-Mir-2-o118 Llo-Mir-2-o119 Llo-Mir-2-o120 Llo-Mir-2-o121 Llo-Mir-2-P12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Gsp-Mir-2 Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Lineidae | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_910592395.2_tnLinLong1) |
OU343002.1: 11595818-11595877 [-] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-2-o115) |
Mir-2-o117
OU343002.1: 11593640-11593697 [-]
Ensembl
Mir-2-o116 OU343002.1: 11594484-11594542 [-] Ensembl Mir-2-o115 OU343002.1: 11595818-11595877 [-] Ensembl Mir-2-P12 OU343002.1: 11596059-11596116 [-] Ensembl Mir-2-o114-v1 OU343002.1: 11598646-11598704 [-] Ensembl Mir-2-o114-v2 OU343002.1: 11598647-11598703 [-] Ensembl Mir-71 OU343002.1: 11598853-11598911 [-] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUCACAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UACGCCGCUAUUAUUGAUGCUGGACAGAGCUGUCAAAGUGGUGGUGAAAUGUUGAAAUGAGAAGCCAUAUCACAGCCAGCUUUGAUGAGCUCGGUCCUCAUUUGUUAUCCGACGAGACGCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UACGCCGCUAUUAUUGAUGCU-- A - -| G A UUGAAA GGAC GAGCU GUCAAAG UGGU GUGA AUG U CCUG CUCGA UAGUUUC ACCG CACU UAC G CGCAGAGCAGCCUAUUGUUUACU G G G^ A A CGAAGA . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Llo-Mir-2-o115_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UGUCAAAGUGGUGGUGAAAUG -21
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Llo-Mir-2-o115_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- UAUCACAGCCAGCUUUGAUGAGC -60
Get sequence
|
