MirGeneDB ID | Llo-Mir-2-o114 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Bootlace worm (Lineus longissimus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Llo-Mir-2-o115 Llo-Mir-2-o116 Llo-Mir-2-o117 Llo-Mir-2-o118 Llo-Mir-2-o119 Llo-Mir-2-o120 Llo-Mir-2-o121 Llo-Mir-2-P12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Gsp-Mir-2 Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | Lineidae | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCA_910592395.2_tnLinLong1) |
OU343002.1: 11598646-11598704 [-] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-2-o114-v1) |
Mir-2-o117
OU343002.1: 11593640-11593697 [-]
Ensembl
Mir-2-o116 OU343002.1: 11594484-11594542 [-] Ensembl Mir-2-o115 OU343002.1: 11595818-11595877 [-] Ensembl Mir-2-P12 OU343002.1: 11596059-11596116 [-] Ensembl Mir-2-o114-v1 OU343002.1: 11598646-11598704 [-] Ensembl Mir-2-o114-v2 OU343002.1: 11598647-11598703 [-] Ensembl Mir-71 OU343002.1: 11598853-11598911 [-] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Variant | Llo-Mir-2-o114-v1 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | CACAGCC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
UCCUUGUCUGUCGAAGUAGCUUGUCCCUUGCUGUCAAUGCUGGACGUAGUAGACAUUCUAAUACCUAUCACAGCCAGCUUUGAUGAGCCAGGUGCAAGUCUGUUGCUGAAAAACAAGUCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 UCCUUGUCUGUCGAAGUA-- UC U -| U AC A GACAUU GCUUG CCU GCU GUCAA GCUGG GU GUA C UGAAC GGA CGA UAGUU CGACC CA UAU U CUGAACAAAAAGUCGUUGUC GU C G^ U GA C CCAUAA 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Llo-Mir-2-o114-v1_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- CUGUCAAUGCUGGACGUAGUA -21
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Llo-Mir-2-o114-v1_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
37- UCACAGCCAGCUUUGAUGAGCC -59
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Variant | Llo-Mir-2-o114-v2 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | AUCACAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
CCUUGUCUGUCGAAGUAGCUUGUCCCUUGCUGUCAAUGCUGGACGUAGUAGACAUUCUAAUACCUAUCACAGCCAGCUUUGAUGAGCCAGGUGCAAGUCUGUUGCUGAAAAACAAGUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 CCUUGUCUGUCGAAGUA-- UC U -| U AC A ACAUU GCUUG CCU GCU GUCAA GCUGG GU GUAG C UGAAC GGA CGA UAGUU CGACC CA UAUC U UGAACAAAAAGUCGUUGUC GU C G^ U GA C CAUAA 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Llo-Mir-2-o114-v2_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- UGUCAAUGCUGGACGUAGUAGA -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Llo-Mir-2-o114-v2_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
34- UAUCACAGCCAGCUUUGAUGAGC -57
Get sequence
|