MirGeneDB

MirGeneDB ID

Lgi-Mir-242-P2

Family name MIR-242 (all species)
Seed UGCGUAG
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-242b
Paralogues Lgi-Mir-242-P1 
Orthologues Bfl-Mir-242  Cbr-Mir-242  Cel-Mir-242  Cgi-Mir-242  Cte-Mir-242  Lan-Mir-242  Pfl-Mir-242  Pmi-Mir-242  Sko-Mir-242  Spu-Mir-242 
Node of Origin (locus) L. gigantea
Node of Origin (family) Bilateria
Genome context
(Lotgi1)
LOTGIsca_16: 1142985-1143041 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-242-P2)
Mir-242-P1 LOTGIsca_16: 1142666-1142720 [-] Ensembl
Mir-242-P2 LOTGIsca_16: 1142985-1143041 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GCUUACUUGAGCAACAGAAAAAUUGAAAUAUUGCGUAGGCAUUGUGCACAGUUGGUCAAUCUCGCUGUGCAUUCUACCUAUACAGUGUUUCGGGCUAUUUGACUUACAUUUGUAUGG
Get precursor sequence
Structure
        10        20          30        40        50        
GCUUACUUGAGCAACAGAAAAA--|          CG    CAUU         UGGUC 
                        UUGAAAUAUUG  UAGG    GUGCACAGU     \
                        GGCUUUGUGAC  AUCC    UACGUGUCG     A
GGUAUGUUUACAUUCAGUUUAUCG^          AU    AUCU         CUCUA 
     110       100        90        80        70        60
Deep sequencing
3' NTU Unknown
MotifsNo
Tissue expression
 +
To
Mature sequence

Lgi-Mir-242-P2_5p (predicted)

MirBase accessionMIMAT0009681
Sequence
0- UUGCGUAGGCAUUGUGCACAGU -22
Get sequence
Star sequence

Lgi-Mir-242-P2_3p* (predicted)

MirBase accessionNone
Sequence
35- UGUGCAUUCUACCUAUACAGUG -57
Get sequence