MirGeneDB

MirGeneDB ID

Lgi-Mir-242-P1

Family name MIR-242 (all species)
Seed UGCGUAG
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-242a
Paralogues Lgi-Mir-242-P2 
Orthologues Bfl-Mir-242  Cbr-Mir-242  Cel-Mir-242  Cgi-Mir-242  Cte-Mir-242  Lan-Mir-242  Pfl-Mir-242  Pmi-Mir-242  Sko-Mir-242  Spu-Mir-242 
Node of Origin (locus) L. gigantea
Node of Origin (family) Bilateria
Genome context
(Lotgi1)
LOTGIsca_16: 1142666-1142720 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-242-P1)
Mir-242-P1 LOTGIsca_16: 1142666-1142720 [-] Ensembl
Mir-242-P2 LOTGIsca_16: 1142985-1143041 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
ACAAUCUGCUACAUGACAGGAAUAAGGUUUUUGCGUAGGCGUUGUGCACAGUUAAAUAGAUAUUGUGUAUUCCCCCUAAGCAUCAAAUUUUAUUACUAGAACAACUUAAUGGCAC
Get precursor sequence
Structure
        10         20        30         40        50       
ACAAUCUGCUACAUGAC-  G          U-|  G    CGUU         UAAA 
                  AG AAUAAGGUUU  UGC UAGG    GUGCACAGU    \
                  UC UUAUUUUAAA  ACG AUCC    UAUGUGUUA    U
CACGGUAAUUCAACAAGA  A          CU^  A    CCCU         UAGA 
   110       100        90        80        70        60
Deep sequencing
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Lgi-Mir-242-P1_5p (predicted)

MirBase accessionMIMAT0009590
Sequence
0- UUGCGUAGGCGUUGUGCACAGU -22
Get sequence
Star sequence

Lgi-Mir-242-P1_3p* (predicted)

MirBase accessionNone
Sequence
33- UGUGUAUUCCCCCUAAGCAUCA -55
Get sequence