MirGeneDB

MirGeneDB ID

Lgi-Mir-1992-P2

Family name MIR-1992 (all species)
Seed CAGCAGU
Species Owl limpet (Lottia gigantea)
MiRBase ID
Paralogues Lgi-Mir-1992-P1 
Orthologues Cgi-Mir-1992  Cte-Mir-1992  Lan-Mir-1992 
Node of Origin (locus) L. gigantea
Node of Origin (family) Lophotrochozoa
Genome context
(Lotgi1)
LOTGIsca_253: 36542-36604 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UUGCACCACUGCAAUUGACGGUGAUGGGACCAGUCAGUGGAUGAUUGUUAUGAUGGCGAUGUUAUUUUAUCAGCAGUUGUACCACUGAUUGGGCUCCAUUUCUUAAAACUUCAAUCUGAUAUA
Get precursor sequence
Structure
        10         20         30        40         50        60 
UUGCACCACUGCAAUUGAC-  U      A-           -|UG     UA     GCGAU 
                    GG GAUGGG  CCAGUCAGUGG A  AUUGU  UGAUG     G
                    UC UUACCU  GGUUAGUCACC U  UGACG  ACUAU     U
AUAUAGUCUAACUUCAAAAU  U      CG           A^GU     --     UUUAU 
 120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Lgi-Mir-1992-P2_5p* (predicted)

MirBase accessionNone
Sequence
0- CAGUCAGUGGAUGAUUGUUAUGAUG -25
Get sequence
Mature sequence

Lgi-Mir-1992-P2_3p

MirBase accessionNone
Sequence
39- UCAGCAGUUGUACCACUGAUUGGG -63
Get sequence