MirGeneDB

MirGeneDB ID

Lgi-Mir-1992-P1

Family name MIR-1992 (all species)
Seed CAGCAGU
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-1992
Paralogues Lgi-Mir-1992-P2 
Orthologues Cgi-Mir-1992  Cte-Mir-1992  Lan-Mir-1992 
Node of Origin (locus) L. gigantea
Node of Origin (family) Lophotrochozoa
Genome context
(Lotgi1)
LOTGIsca_253: 35945-36002 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UAUUUUAUCAGACAGAAAAUGUUGUUGAUAAGUCAGUGGAUGAUUGCAGGAUAUUCCAUCAGUUAUCAGCAGUUGUACCACUGAUUUGUUAAUGAUAUCCAUCCUUCAACUAGACAUU
Get precursor sequence
Structure
        10          20        30         40        50        
UAUUUUAUCAGACAGAAA--    UG               -|UG     AG    UUCC 
                    AUGU  UUGAUAAGUCAGUGG A  AUUGC  GAUA    A
                    UAUA  AAUUGUUUAGUCACC U  UGACG  CUAU    U
UUACAGAUCAACUUCCUACC    GU               A^GU     A-    UGAC 
      110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Lgi-Mir-1992-P1_5p* (predicted)

MirBase accessionNone
Sequence
0- AGUCAGUGGAUGAUUGCAGGAUA -23
Get sequence
Mature sequence

Lgi-Mir-1992-P1_3p

MirBase accessionMIMAT0009722
Sequence
35- UCAGCAGUUGUACCACUGAUUUG -58
Get sequence