MirGeneDB

MirGeneDB ID

Lgi-Mir-1989

Family name MIR-1989 (all species)
Seed CAGCUGU
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-1989
Paralogues
Orthologues Cgi-Mir-1989  Cte-Mir-1989  Lan-Mir-1989-P1  Lan-Mir-1989-P2  Lan-Mir-1989-P3 
Node of Origin (locus) Lophotrochozoa
Node of Origin (family) Lophotrochozoa
Genome context
(Lotgi1)
LOTGIsca_2: 5468355-5468415 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AUAUCUCGAGUUCUUACACGAGGGAGACUAUCAGCUGUCAUGAUGCCUUCCUGUUUUGGAAGAGUUUGGGUAGGCAUUAUGAAGGUUGGUAAUUUCCUUUGUUAAAAUCAACAACUCCCAC
Get precursor sequence
Structure
        10          20        30        40        50          
AUAUCUCGAGUUCUUAC--|         C        G           U   GUUUUGG 
                   ACGAGGGAGA UAUCAGCU UCAUGAUGCCU CCU       \
                   UGUUUCCUUU AUGGUUGG AGUAUUACGGA GGG       A
CACCCUCAACAACUAAAAU^         A        A           U   UUUGAGA 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Lgi-Mir-1989_5p (predicted)

MirBase accessionMIMAT0009730
Sequence
0- UCAGCUGUCAUGAUGCCUUCCU -22
Get sequence
Star sequence

Lgi-Mir-1989_3p*

MirBase accessionNone
Sequence
39- GUAGGCAUUAUGAAGGUUGGUA -61
Get sequence