MirGeneDB

MirGeneDB ID

Dan-Mir-977

Family name MIR-977 (all species)
Seed CGAUCAC
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues Dme-Mir-977  Dmo-Mir-977 
Node of Origin (locus) Drosophila
Node of Origin (family) Drosophila
Genome context
(Dana_caf1)
scaffold_13417: 2467469-2467532 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GAGGCACACGCGUACCGCCGAGGUUCGGCCUCGAUCACGAGAACGUCGCAUCUUAGUUACAUUUCCAUAUGAUGAGAUAUUCACGUCGUCGAAACCGUGUCUCGGCUUGGCCACCAAUCGCAAG
Get precursor sequence
Structure
        10          20        30        40        50        60 
GAGGCACACGCGUACCG--|     UU   CC     C   A   CG  G    UUAGUUAC 
                   CCGAGG  CGG  UCGAU ACG GAA  UC CAUC        A
                   GGCUCU  GCC  AGCUG UGC CUU  AG GUAG        U
GAACGCUAACCACCGGUUC^     GU   AA     C   A   AU  A    UAUACCUU 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Mature sequence

Dan-Mir-977_5p

MirBase accessionNone
Sequence
0- UCGAUCACGAGAACGUCGCAUC -22
Get sequence
Co-mature sequence

Dan-Mir-977_3p

MirBase accessionNone
Sequence
42- UGAGAUAUUCACGUCGUCGAAA -64
Get sequence