MirGeneDB

MirGeneDB ID

Dan-Mir-975

Family name MIR-975 (all species)
Seed CGGAUGU
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues Dme-Mir-975  Dmo-Mir-975 
Node of Origin (locus) Drosophila
Node of Origin (family) Drosophila
Genome context
(Dana_caf1)
scaffold_13417: 2467720-2467781 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CCAAGCCAGUCGACAAUGAAUAUUUGAUUUUAAACACUACCUACAUCCAGUAUGUUACUUGACUCCCAAUACGGAUGUGGAGGGCGUUUACACUCAGAGAUUCUGGAGCCACUGCCGUCCAG
Get precursor sequence
Structure
        10          20        30        40        50        60 
CCAAGCCAGUCGACAAU--|   A     UUU     A  AC        A    GUUACUU 
                   GAAU UUUGA   UAAAC CU  CUACAUCC GUAU       \
                   CUUA AGACU   AUUUG GG  GGUGUAGG CAUA       G
GACCUGCCGUCACCGAGGU^   G     CAC     C  GA        -    ACCCUCA 
120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-975_5p*

MirBase accessionNone
Sequence
0- UAAACACUACCUACAUCCAGUAU -23
Get sequence
Mature sequence

Dan-Mir-975_3p

MirBase accessionNone
Sequence
40- ACGGAUGUGGAGGGCGUUUACA -62
Get sequence