MirGeneDB

MirGeneDB ID

Dan-Mir-978-v2

Family name MIR-978 (all species)
Seed UGUCCAG
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues Dan-Mir-978-v1 
Orthologues Dme-Mir-978-v2 
Node of Origin (locus) Drosophila melanogaster group
Node of Origin (family) Drosophila melanogaster group
Genome context
(Dana_caf1)
scaffold_13417: 2460541-2460600 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CGGACAGGGCAAGCUCGGCGGCACAGACAGCAUUCGACGCUGCUGGCUUACGUGGUGGUUGAUAUCCGUGUCCAGUGACGUUGAUUGCAGUUGUGUAGACGCGAAUUACAGCGACCGAUA
Get precursor sequence
Structure
        10         20           30        40        50          
CGGACAGGGCAAGCUCG-   ---|     ACA   U      CU     CU    U  UGGU 
                  GCG   GCACAG   GCA UCGACG  GCUGG  UACG GG    \
                  CGC   UGUGUU   CGU AGUUGC  UGACC  GUGC CU    U
AUAGCCAGCGACAUUAAG   AGA^     GA-   U      AG     U-    -  AUAG 
.       110       100        90         80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Da
Star sequence

Dan-Mir-978-v2_5p*

MirBase accessionNone
Sequence
0- CAUUCGACGCUGCUGGCUUACGUGG -25
Get sequence
Mature sequence

Dan-Mir-978-v2_3p

MirBase accessionNone
Sequence
37- GUGUCCAGUGACGUUGAUUGCAG -60
Get sequence