MirGeneDB

MirGeneDB ID

Dmo-Mir-977

Family name MIR-977 (all species)
Seed GAGAUAU
Species Fruit fly (Drosophila mojavensis)
MiRBase ID
Paralogues
Orthologues Dan-Mir-977  Dme-Mir-977 
Node of Origin (locus) Drosophila
Node of Origin (family) Drosophila
Genome context
(Dmoj_caf1)
scaffold_6328: 2900861-2900925 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
ACCAGUUCGUUGUUCUGGCCCAGCCCGGUUCCGAUUGCGCGGACAUCUCAUCGUCUGACCAUUCGAUAACCGAUGAGAUAUUCACGUUAUCGAGACUGCGACAGCGGCACUGACUUCAAAUUUGU
Get precursor sequence
Structure
        10           20         30        40        50        60  
ACCAGUUCGUUGUUCUG---  CCA-| CC   UC    U   C   C        GUCUGACCA 
                    GC    GC  GGU  CGAU GCG GGA AUCUCAUC         \
                    CG    CG  UCA  GCUA UGC CUU UAGAGUAG         U
UGUUUAAACUUCAGUCACGG  ACAG^ --   GA    U   A   A        CCAAUAGCU 
   120       110       100          90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Em Fe Ma Ma
Star sequence

Dmo-Mir-977_5p*

MirBase accessionNone
Sequence
0- CCGAUUGCGCGGACAUCUCAUC -22
Get sequence
Mature sequence

Dmo-Mir-977_3p

MirBase accessionNone
Sequence
43- UGAGAUAUUCACGUUAUCGAGA -65
Get sequence