MirGeneDB

MirGeneDB ID

Cli-Mir-32

Family name MIR-32 (all species)
Seed AUUGCAC
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-32
Paralogues
Orthologues Aca-Mir-32  Ami-Mir-32  Bta-Mir-32  Cfa-Mir-32  Cpi-Mir-32  Cpo-Mir-32  Dno-Mir-32  Ete-Mir-32  Gga-Mir-32  Hsa-Mir-32  Mdo-Mir-32  Mml-Mir-32  Mmu-Mir-32  Oan-Mir-32  Ocu-Mir-32  Rno-Mir-32  Sha-Mir-32  Sto-Mir-32  Tgu-Mir-32 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(colLiv2)
scaffold231: 729048-729109 [-]
Precursor
(pre-Mir +30nt flank)
AAGCUCCCAUUCUGCUUGCUCUGGUGGAGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCAGUGCAAUUUAGUGUGUGCGAUACUUUCACAUGAGUGCAUGCACACGGGUAUGGC
Get precursor sequence
Structure
        10          20        30        40        50        60 
AAGCUCCCAUUCUGCUU--|   UG      A          U           UGUUGUCA 
                   GCUC  GUGGAG UAUUGCACAU ACUAAGUUGCA        \
                   UGAG  CACUUU AUAGCGUGUG UGAUUUAACGU        C
CGGUAUGGGCACACGUACG^   UA      C          -           GACUCCGG 
120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), UGUG in loop
Tissue expression
 +
To
Mature sequence

Cli-Mir-32_5p

MirBase accessionMIMAT0038462
Sequence
0- UAUUGCACAUUACUAAGUUGCA -22
Get sequence
Star sequence

Cli-Mir-32_3p*

MirBase accessionMIMAT0038463
Sequence
41- CAAUUUAGUGUGUGCGAUACU -62
Get sequence