MirGeneDB

MirGeneDB ID

Sto-Mir-32

Family name MIR-32 (all species)
Seed AUUGCAC
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues
Orthologues Aca-Mir-32  Ami-Mir-32  Bta-Mir-32  Cfa-Mir-32  Cli-Mir-32  Cpi-Mir-32  Cpo-Mir-32  Dno-Mir-32  Ete-Mir-32  Gga-Mir-32  Hsa-Mir-32  Mdo-Mir-32  Mml-Mir-32  Mmu-Mir-32  Oan-Mir-32  Ocu-Mir-32  Rno-Mir-32  Sha-Mir-32  Tgu-Mir-32 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(miRNA_loci_genome)
BFAA01000988.1: 609683-609744 [+]
Precursor
(pre-Mir +30nt flank)
CACUUCCCAUUCUGCUUGCUCUGGUGGAGGCAUUGCACACUACCAAGUUGCAUGUUGUGAGAGCCUCAGUGCAGCUUGGUGUGUGUGAUACUUUCAUGUGAGUGCAUGCGCACUGGUAUGAC
Get precursor sequence
Structure
        10          20        30        40        50        60 
CACUUCCCAUUCUGCUU--|   UG       C  UG     U           UGUUGUGA 
                   GCUC  GUGGAGG AU  CACAC ACCAAGUUGCA        \
                   UGAG  UACUUUC UA  GUGUG UGGUUCGACGU        G
CAGUAUGGUCACGCGUACG^   UG       A  GU     -           GACUCCGA 
120       110       100        90         80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site +1 relative to what is annotated here.
3' NTU No
MotifsUG at 5p(-14), UGUG in loop
Tissue expression
 +
To
Mature sequence

Sto-Mir-32_5p

MirBase accessionNone
Sequence
0- CAUUGCACACUACCAAGUUGCA -22
Get sequence
Star sequence

Sto-Mir-32_3p*

MirBase accessionNone
Sequence
41- CAGCUUGGUGUGUGUGAUACU -62
Get sequence