MirGeneDB

MirGeneDB ID

Bta-Mir-192-P1

Family name MIR-192 (all species)
Seed UGACCUA
Species Cow (Bos taurus)
MiRBase ID bta-mir-192
Paralogues Bta-Mir-192-P2 
Orthologues Ami-Mir-192-P1  Cfa-Mir-192-P1  Cpi-Mir-192-P1  Cpo-Mir-192-P1  Dno-Mir-192-P1  Dre-Mir-192-P1  Ete-Mir-192-P1  Hsa-Mir-192-P1  Mml-Mir-192-P1  Mmu-Mir-192-P1  Oan-Mir-192-P1  Rno-Mir-192-P1  Sha-Mir-192-P1  Xtr-Mir-192-P1 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Vertebrata
Genome context
(bosTau8)
chr29: 43731679-43731743 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-192-P1)
Mir-194-P1 chr29: 43731474-43731530 [+] UCSC Ensembl
Mir-192-P1 chr29: 43731679-43731743 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCAGGCUGCCAAGACCGAGUGCACAGGGCUCUGACCUAUGAAUUGACAGCCAGUGCUCUUGUGUCCCCUCUGGCUGCCAAUUCCAUAGGUCACAGGUAUGUUCGCCUCAAUGCCAGCCACCAGGA
Get precursor sequence
Structure
        10          20        30          40        50        60 
GCAGGCUGCCAAGACCGA--   C   GG   C-        -|     A     AGUGCUCUU 
                    GUG ACA  GCU  UGACCUAU GAAUUG CAGCC         G
                    CGC UGU  UGG  ACUGGAUA CUUAAC GUCGG         U
AGGACCACCGACCGUAACUC   U   A-   AC        C^     C     UCUCCCCUG 
   120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsNo
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-192-P1_5p

MirBase accessionMIMAT0003820
Sequence
0- CUGACCUAUGAAUUGACAGCC -21
Get sequence
Validated targets TargetScanVert: bta-miR-192
Star sequence

Bta-Mir-192-P1_3p*

MirBase accessionNone
Sequence
43- CUGCCAAUUCCAUAGGUCACAG -65
Get sequence