MirGeneDB

MirGeneDB ID

Mmu-Mir-192-P1

Family name MIR-192 (all species)
Seed UGACCUA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-192
Paralogues Mmu-Mir-192-P2 
Orthologues Ami-Mir-192-P1  Bta-Mir-192-P1  Cfa-Mir-192-P1  Cpi-Mir-192-P1  Cpo-Mir-192-P1  Dno-Mir-192-P1  Dre-Mir-192-P1  Ete-Mir-192-P1  Hsa-Mir-192-P1  Mml-Mir-192-P1  Oan-Mir-192-P1  Rno-Mir-192-P1  Sha-Mir-192-P1  Xtr-Mir-192-P1 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr19: 6264857-6264921 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-192-P1)
Mir-194-P1 chr19: 6264658-6264715 [+] UCSC Ensembl
Mir-192-P1 chr19: 6264857-6264921 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCAGGCUGCCAAGAUGGCGUGCACAGGGCUCUGACCUAUGAAUUGACAGCCAGUACUCUUUUCUCUCCUCUGGCUGCCAAUUCCAUAGGUCACAGGUAUGUUCACCUCAAUGCCAGCCAUAACGA
Get precursor sequence
Structure
        10          20        30          40        50        60 
GCAGGCUGCCAAGAUGGC--   C   GG   C-        -|     A     AGUACUCUU 
                    GUG ACA  GCU  UGACCUAU GAAUUG CAGCC         U
                    CAC UGU  UGG  ACUGGAUA CUUAAC GUCGG         U
AGCAAUACCGACCGUAACUC   U   A-   AC        C^     C     UCUCCUCUC 
   120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsNo
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-192-P1_5p

MirBase accessionMIMAT0000517
Sequence
0- CUGACCUAUGAAUUGACAGCC -21
Get sequence
Validated targets microrna.org: MIMAT0000517
TargetScanVert: mmu-miR-192-5p
miRDB: MIMAT0000517
Star sequence

Mmu-Mir-192-P1_3p*

MirBase accessionMIMAT0017012
Sequence
43- CUGCCAAUUCCAUAGGUCACAG -65
Get sequence
Validated targets TargetScanVert: mmu-miR-192-3p
miRDB: MIMAT0017012