MirGeneDB

MirGeneDB ID

Cte-Mir-279-o11

Family name MIR-279 (all species)
Seed GACUAGA
Species Polychaete worm (Capitella teleta)
MiRBase ID cte-mir-279
Paralogues Cte-Mir-279-o12  Cte-Mir-279-o13 
Orthologues Cgi-Mir-279  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) C. teleta
Node of Origin (family) Protostomia
Genome context
(Capitella_teleta_v1.0)
CAPTEscaffold_19: 703521-703582 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-279-o11)
Mir-36 CAPTEscaffold_19: 701730-701789 [-] Ensembl
Mir-279-o11 CAPTEscaffold_19: 703521-703582 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CGAUUUUGUGUCGUUUCGCUGUCGCCUUGAAUGGCUGUGGAUCAAGUCCAUGUUAAGAUUUCGAAUUGUCAUGACUAGAUCCACACUCAUCCAGGUUGGCGGCUAGCCCUUCGUUUGAAAAU
Get precursor sequence
Structure
        10          20        30        40        50        60 
CGAUUUUGUGUCGUUUC--|      C    A   GC        A    C   UUAAGAUU 
                   GCUGUCG CUUG AUG  UGUGGAUC AGUC AUG        \
                   CGGCGGU GGAC UAC  ACACCUAG UCAG UAC        U
UAAAAGUUUGCUUCCCGAU^      U    C   UC        A    -   UGUUAAGC 
120       110       100        90        80         70
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-279 genes were present in the last common ancestor of protostomes and how the Drosophila Mir-279s relate to the other invertebrate Mir-279s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Cte-Mir-279-o11_5p* (predicted)

MirBase accessionNone
Sequence
0- AUGGCUGUGGAUCAAGUCCAUG -22
Get sequence
Mature sequence

Cte-Mir-279-o11_3p

MirBase accessionMIMAT0009539
Sequence
41- UGACUAGAUCCACACUCAUCC -62
Get sequence