MirGeneDB

MirGeneDB ID

Cte-Mir-279-o13

Family name MIR-279 (all species)
Seed GACUAGA
Species Polychaete worm (Capitella teleta)
MiRBase ID cte-mir-2720
Paralogues Cte-Mir-279-o11  Cte-Mir-279-o12 
Orthologues Cgi-Mir-279  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) C. teleta
Node of Origin (family) Protostomia
Genome context
(Capitella_teleta_v1.0)
CAPTEscaffold_39: 146223-146291 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-279-o13)
Mir-279-o12 CAPTEscaffold_39: 146002-146056 [+] Ensembl
Mir-279-o13 CAPTEscaffold_39: 146223-146291 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CUUCCUUUUCUCUGCUGACUGCCUGUCUGUCUGGGUAAUCGCUCUAGACCAUGUGAUGUCGCAUGCUGCAGCGCUCAUGACUAGAGAGUUUACUCAUCCAGAGAGUAGUCUCCUUCUUCUCAUUGUUAG
Get precursor sequence
Structure
        10           20        30        40        50        60    
CUUCCUUUUCUCUGCUG---|    C G    UC       UCG      AC   GUGAUGUCGCA 
                    ACUGC U UCUG  UGGGUAA   CUCUAG  CAU           U
                    UGAUG A AGAC  ACUCAUU   GAGAUC  GUA           G
GAUUGUUACUCUUCUUCCUC^    - G    CU       UGA      A-   CUCGCGACGUC 
       120       110        100        90        80         70
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-279 genes were present in the last common ancestor of protostomes and how the Drosophila Mir-279s relate to the other invertebrate Mir-279s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data.
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Star sequence

Cte-Mir-279-o13_5p*

MirBase accessionMIMAT0013554
Sequence
0- CUGGGUAAUCGCUCUAGACCAU -22
Get sequence
Mature sequence

Cte-Mir-279-o13_3p

MirBase accessionMIMAT0013555
Sequence
47- UGACUAGAGAGUUUACUCAUCC -69
Get sequence