MirGeneDB

MirGeneDB ID

Cte-Mir-279-o12

Family name MIR-279 (all species)
Seed GACUAGA
Species Polychaete worm (Capitella teleta)
MiRBase ID cte-mir-996
Paralogues Cte-Mir-279-o11  Cte-Mir-279-o13 
Orthologues Cgi-Mir-279  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) C. teleta
Node of Origin (family) Protostomia
Genome context
(Capitella_teleta_v1.0)
CAPTEscaffold_39: 146002-146056 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-279-o12)
Mir-279-o12 CAPTEscaffold_39: 146002-146056 [+] Ensembl
Mir-279-o13 CAPTEscaffold_39: 146223-146291 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UUUCACUGUUGGCUGAUGCCAUUGGCGGAGGCGGGUGUGCUGUCUGGUGCGUGUGUUUCACCAUGACUAGAUAACACAUUCGUCUCUGCCUCUUGAGCACCCUCGUCCUGUUAUG
Get precursor sequence
Structure
        10         20         30        40        50       
UUUCACUGUUGGCUGAUGC-  UU-|               C        G    UGU 
                    CA   GGCGGAGGCGGGUGUG UGUCUGGU CGUG   U
                    GU   CCGUCUCUGCUUACAC AUAGAUCA GUAC   U
GUAUUGUCCUGCUCCCACGA  UCU^               A        -    CAC 
   110       100        90        80        70         60
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-279 genes were present in the last common ancestor of protostomes and how the Drosophila Mir-279s relate to the other invertebrate Mir-279s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Star sequence

Cte-Mir-279-o12_5p* (predicted)

MirBase accessionNone
Sequence
0- GCGGGUGUGCUGUCUGGUGCGUG -23
Get sequence
Mature sequence

Cte-Mir-279-o12_3p

MirBase accessionMIMAT0013552
Sequence
33- UGACUAGAUAACACAUUCGUCU -55
Get sequence