MirGeneDB

MirGeneDB ID

Cli-Mir-1677-P4

Family name MIR-1677 (all species)
Seed GACUUAA
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-1784
Paralogues Cli-Mir-1677-P1  Cli-Mir-1677-P2  Cli-Mir-1677-P5  Cli-Mir-1677-P6 
Orthologues Ami-Mir-1677-o4  Cpi-Mir-1677-P4  Gga-Mir-1677-P4  Tgu-Mir-1677-P4 
Node of Origin (locus) Archelosauria
Node of Origin (family) Diapsida
Genome context
(colLiv2)
scaffold232: 10503091-10503148 [-]
Precursor
(pre-Mir +30nt flank)
ACUACUGUGGACCAAUUUCUUGGGGCCCAAUUCUGCUCUUAUUGAAAUCAGUGAGAGUUCUGCCAUUGACUUAAAUGGGAGCAGAAUUGGGACCUAAGAAGACCUUUGCAGUUCUGGG
Get precursor sequence
Structure
        10          20        30        40        50        
ACUACUGUGGACCAAUU--|      G                  G  A      AGAG 
                   UCUUGGG CCCAAUUCUGCUCUUAUU AA UCAGUG    U
                   AGAAUCC GGGUUAAGACGAGGGUAA UU AGUUAC    U
GGGUCUUGACGUUUCCAGA^      A                  A  C      CGUC 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Cli-Mir-1677-P4_5p* (predicted)

MirBase accessionMIMAT0038699
Sequence
0- UUCUGCUCUUAUUGAAAUCAGUG -23
Get sequence
Mature sequence

Cli-Mir-1677-P4_3p (predicted)

MirBase accessionNone
Sequence
36- UGACUUAAAUGGGAGCAGAAUU -58
Get sequence