MirGeneDB

MirGeneDB ID

Bge-Mir-210-v2

Family name MIR-210 (all species)
Seed GCUGCUG
Species Cockroach (Blattella germanica)
MiRBase ID
Paralogues Bge-Mir-210-v1 
Orthologues Aae-Mir-210-v2  Aca-Mir-210  Ami-Mir-210  Bfl-Mir-210  Bta-Mir-210  Cfa-Mir-210  Cgi-Mir-210  Cli-Mir-210  Cpi-Mir-210  Cpo-Mir-210  Dan-Mir-210-v2  Dme-Mir-210-v2  Dmo-Mir-210-v2  Dno-Mir-210  Dpu-Mir-210  Dre-Mir-210  Efe-Mir-210  Ete-Mir-210  Gga-Mir-210  Hsa-Mir-210  Isc-Mir-210  Lan-Mir-210  Lgi-Mir-210  Mdo-Mir-210  Mml-Mir-210  Mmu-Mir-210  Oan-Mir-210  Ocu-Mir-210  Pfl-Mir-210  Pmi-Mir-210  Rno-Mir-210  Sha-Mir-210  Sko-Mir-210  Spu-Mir-210-v2  Tca-Mir-210-v2  Tgu-Mir-210  Xtr-Mir-210 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Bger_2.0)
KZ615127.1: 109417-109476 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AUCAACCAAAGGAGAGGAGUAACCCACGGCAGCUGCUGGACACUGCACAAGAUUAGCGAUUAAAACUCUUGUGCGUGUGACAGCGGCUAUUGUAGUUGCUCGCCGCGACGACAUCACCAU
Get precursor sequence
Structure
        10           20        30         40        50         
AUCAACCAAAGGAGAGG---|     CC    C        G-    U        UUAGCG 
                    AGUAAC  ACGG AGCUGCUG  ACAC GCACAAGA      A
                    UCGUUG  UGUU UCGGCGAC  UGUG CGUGUUCU      U
UACCACUACAGCAGCGCCGC^     A-    A        AG    -        CAAAAU 
.       110       100         90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ny Ny Ny Ny Ny Ny Ny Ny Ov Co Co Em Em Em Em Em Em Em Em Em Em No No
Mature sequence

Bge-Mir-210-v2_5p

MirBase accessionNone
Sequence
0- AGCUGCUGGACACUGCACAAGAU -23
Get sequence
Co-mature sequence

Bge-Mir-210-v2_3p

MirBase accessionNone
Sequence
37- CUUGUGCGUGUGACAGCGGCUAU -60
Get sequence