MirGeneDB

MirGeneDB ID

Sto-Mir-725

Family name MIR-725 (all species)
Seed UCAGUCA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues
Orthologues Dre-Mir-725  Xtr-Mir-725 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(miRNA_loci_genome)
BFAA01010030.1: 108038-108096 [-]
Precursor
(pre-Mir +30nt flank)
UCUGGAAGUUCCGAUGUGGACUGUUCACCUCACCUGAAACAGUGCCUGAAAUAAUAUUCAGGGAUUUAUCAGUCAUUGUUUUGGGUGGAGUGCAGUGAUCACUAUUCUGCUGAGACUCA
Get precursor sequence
Structure
        10            20        30        40        50         
UCUGGAAGUUCCGAUGUGG----|   UU   CU    UG        C    AAUAAUAUU 
                       ACUG  CAC  CACC  AAACAGUG CUGA         \
                       UGAC  GUG  GUGG  UUUGUUAC GACU         C
ACUCAGAGUCGUCUUAUCACUAG^   --   AG    GU        U    AUUUAGGGA 
       110       100          90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Mir-725_5p*

MirBase accessionNone
Sequence
0- CACCUGAAACAGUGCCUGAAAUAA -24
Get sequence
Mature sequence

Sto-Mir-725_3p

MirBase accessionNone
Sequence
37- AUCAGUCAUUGUUUUGGGUGGA -59
Get sequence