MirGeneDB

MirGeneDB ID

Sto-Mir-196-P3

Family name MIR-196 (all species)
Seed AGGUAGU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-196-P1 
Orthologues Aca-Mir-196-P3  Ami-Mir-196-P3  Bta-Mir-196-P3  Cfa-Mir-196-P3  Cin-Mir-196  Cli-Mir-196-P3  Cpi-Mir-196-P3  Cpo-Mir-196-P3  Dno-Mir-196-P3  Dre-Mir-196-P3a  Dre-Mir-196-P3b  Ete-Mir-196-P3  Gga-Mir-196-P3e  Gga-Mir-196-P3f  Gga-Mir-196-P3g  Hsa-Mir-196-P3  Mdo-Mir-196-P3  Mml-Mir-196-P3  Mmu-Mir-196-P3  Oan-Mir-196-P3  Ocu-Mir-196-P3  Rno-Mir-196-P3c  Rno-Mir-196-P3d  Sha-Mir-196-P3  Tgu-Mir-196-P3  Xtr-Mir-196-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Olfactores
Genome context
(miRNA_loci_genome)
BFAA01000097.1: 1251099-1251156 [-]
Precursor
(pre-Mir +30nt flank)
AAAGAGCAGAGAUAGAACUGAUGUGUGAUUUAGGUAGUUUCAUGUUGUUGGGGCUCAAGUCUAUCUCUACAACACGAAACUGCCUGAAUUACUGCAGUUAUCGUCUUCGCCAGUGAGU
Get precursor sequence
Structure
        10            20        30        40        50         
AAAGAGCAGAGAUAGAA----|  AUGU                 A      U   GCUCAA 
                     CUG    GUGAUUUAGGUAGUUUC UGUUGU GGG      \
                     GAC    CAUUAAGUCCGUCAAAG ACAACA UCU      G
UGAGUGACCGCUUCUGCUAUU^  GU--                 C      -   CUAUCU 
      110       100          90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Sto-Mir-196-P3_5p

MirBase accessionNone
Sequence
0- UAGGUAGUUUCAUGUUGUUGGG -22
Get sequence
Star sequence

Sto-Mir-196-P3_3p*

MirBase accessionNone
Sequence
36- CUACAACACGAAACUGCCUGAA -58
Get sequence