MirGeneDB

MirGeneDB ID

Rno-Mir-345

Family name MIR-345 (all species)
Seed GCUGACC
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-345
Paralogues
Orthologues Bta-Mir-345  Cfa-Mir-345  Cpo-Mir-345  Dno-Mir-345  Ete-Mir-345  Hsa-Mir-345  Mml-Mir-345  Mmu-Mir-345 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(rn6)
chr6: 132748983-132749042 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUUCGUGAAGCCGACACCCAAGUCCAGGCCUGCUGACCCCUAGUCCAGUGCUUGUGGUGGCUACUGGGCCCUGAACUAGGGGUCUGGAGACCUGGGUUUGAUCUCCACAGGCUUUGCGUC
Get precursor sequence
Structure
        10          20        30         40        50         
CUUCGUGAAGCCGACACC--|  GU     C  G  -          C   U  UUGUGGU 
                    CAA  CCAGG CU CU GACCCCUAGU CAG GC       G
                    GUU  GGUCC GA GG CUGGGGAUCA GUC CG       G
CUGCGUUUCGGACACCUCUA^  UG     A  -  U          A   C  GGUCAUC 
.       110       100        90         80        70        60
Deep sequencing
Go to detailed chart
CommentThe murid rodents have shifted both the Drosha and Dicer cut -1 relative to the other mammals.
3' NTU Yes
MotifsNo
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-345_5p

MirBase accessionMIMAT0000594
Sequence
0- UGCUGACCCCUAGUCCAGUGC -21
Get sequence
Validated targets microrna.org: MIMAT0000594
TargetScanVert: rno-miR-345-5p
miRDB: MIMAT0000594
Co-mature sequence

Rno-Mir-345_3p

MirBase accessionMIMAT0004655
Sequence
39- CCUGAACUAGGGGUCUGGAGA -60
Get sequence
Validated targets microrna.org: MIMAT0004655
TargetScanVert: rno-miR-345-3p
miRDB: MIMAT0004655