MirGeneDB

MirGeneDB ID

Rno-Mir-335

Family name MIR-335 (all species)
Seed CAAGAGC
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-335
Paralogues
Orthologues Bta-Mir-335  Cfa-Mir-335  Cpo-Mir-335  Dno-Mir-335  Ete-Mir-335  Hsa-Mir-335  Mml-Mir-335  Mmu-Mir-335  Ocu-Mir-335 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(rn6)
1660748194: 214-275 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACAUUGGAAAAGACUUCUUUUGGGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUUUUUCGUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGUUAUAGCCAGGCGAGUAA
Get precursor sequence
Structure
        10        20          30        40        50        60
ACAUUGGAAAAGACUUCUUU--|   C        A         C        UUUGUUU 
                      UGGG GGGGGUCA GAGCAAUAA GAAAAAUG       U
                      ACUC CCUCCAGU CUCGUUAUU CUUUUUGC       U
AAUGAGCGGACCGAUAUUGUUU^   U        C         A        CAAAUGC 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentNot in assembly but in trace archive.
3' NTU No
MotifsNo
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-335_5p

MirBase accessionMIMAT0000575
Sequence
0- UCAAGAGCAAUAACGAAAAAUG -22
Get sequence
Validated targets microrna.org: MIMAT0000575
TargetScanVert: rno-miR-335
miRDB: MIMAT0000575
Star sequence

Rno-Mir-335_3p*

MirBase accessionNone
Sequence
40- UUUUUCAUUAUUGCUCCUGACC -62
Get sequence