MirGeneDB

MirGeneDB ID

Rno-Mir-296

Family name MIR-296 (all species)
Seed GGGCCCC
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-296
Paralogues
Orthologues Bta-Mir-296  Cfa-Mir-296  Cpo-Mir-296  Dno-Mir-296  Hsa-Mir-296  Mml-Mir-296  Mmu-Mir-296 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(rn6)
chr3: 172357500-172357555 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-296)
Mir-296 chr3: 172357500-172357555 [-] UCSC Ensembl
Mir-298 chr3: 172357950-172358014 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUGGAUGAUGACAAGAAAGGACCUUUCUGGAGGGCCCCCCCUCAAUCCUGUUGUGCUCGCUUCAGAGGGUUGGGUGGAGGCUCUCCUGAAGGUGUCUAUAGAGCAUCGCAUGGUGA
Get precursor sequence
Structure
        10         20         30        40        50       
GUGGAUGAUGACAAGAAA-    -|    U        C  C         GUUGUGC 
                   GGAC CUUUC GGAGGGCC CC CUCAAUCCU       U
                   UCUG GGAAG CCUCUCGG GG GGGUUGGGA       C
AGUGGUACGCUACGAGAUA    U^    U        A  U         GACUUCG 
    110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site +1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-296_5p

MirBase accessionMIMAT0000898
Sequence
0- AGGGCCCCCCCUCAAUCCUGU -21
Get sequence
Validated targets microrna.org: MIMAT0000898
TargetScanVert: rno-miR-296-5p
miRDB: MIMAT0000898
Co-mature sequence

Rno-Mir-296_3p

MirBase accessionMIMAT0004742
Sequence
35- AGGGUUGGGUGGAGGCUCUCC -56
Get sequence
Validated targets microrna.org: MIMAT0004742
TargetScanVert: rno-miR-296-3p
miRDB: MIMAT0004742