MirGeneDB

MirGeneDB ID

Rno-Mir-147-v1

Family name MIR-147 (all species)
Seed UGUGCGG
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-147
Paralogues Rno-Mir-147-v2 
Orthologues Aca-Mir-147-v1  Ami-Mir-147-v1  Bta-Mir-147  Cfa-Mir-147-v1  Cli-Mir-147  Cpi-Mir-147-v1  Cpo-Mir-147-v1  Dno-Mir-147-v1  Gga-Mir-147  Hsa-Mir-147-v1  Mdo-Mir-147  Mml-Mir-147  Mmu-Mir-147-v1  Oan-Mir-147  Ocu-Mir-147  Sha-Mir-147  Tgu-Mir-147 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(rn6)
chr3: 114775353-114775411 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-147-v1)
Mir-147-v1 chr3: 114775353-114775411 [+] UCSC Ensembl
Mir-147-v2 chr3: 114775354-114775410 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUUUCUUCCAAAGAACACUCUAUGAAUCUAGUGGAAACACUUCUGCACAAACUCGAUUUUGAUGCCAGUGUGCGGAAAUGCUUCUGCUACAUUUUUAGGGUUUGCCUGCAUUCUUUGGA
Get precursor sequence
Structure
        10          20        30        40        50         
CUUUCUUCCAAAGAACA--|    U    C   UG   A  C         AACUCGAUU 
                   CUCUA GAAU UAG  GAA CA UUCUGCACA         \
                   GGGAU UUUA AUC  CUU GU AAGGCGUGU         U
AGGUUUCUUACGUCCGUUU^    U    C   GU   C  A         GACCGUAGU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-147-v1_5p*

MirBase accessionNone
Sequence
0- GUGGAAACACUUCUGCACAAACU -23
Get sequence
Mature sequence

Rno-Mir-147-v1_3p

MirBase accessionMIMAT0005297
Sequence
37- GUGUGCGGAAAUGCUUCUGCUA -59
Get sequence
Validated targets microrna.org: MIMAT0005297
TargetScanVert: rno-miR-147
miRDB: MIMAT0005297