MirGeneDB

MirGeneDB ID

Bta-Mir-147

Family name MIR-147 (all species)
Seed UGUGCGG
Species Cow (Bos taurus)
MiRBase ID bta-mir-147
Paralogues
Orthologues Aca-Mir-147-v1  Aca-Mir-147-v2  Ami-Mir-147-v1  Ami-Mir-147-v2  Cfa-Mir-147-v1  Cfa-Mir-147-v2  Cli-Mir-147  Cpi-Mir-147-v1  Cpi-Mir-147-v2  Cpo-Mir-147-v1  Cpo-Mir-147-v2  Dno-Mir-147-v1  Dno-Mir-147-v2  Gga-Mir-147  Hsa-Mir-147-v1  Hsa-Mir-147-v2  Mdo-Mir-147  Mml-Mir-147  Mmu-Mir-147-v1  Mmu-Mir-147-v2  Oan-Mir-147  Ocu-Mir-147  Rno-Mir-147-v1  Rno-Mir-147-v2  Sha-Mir-147  Tgu-Mir-147 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(bosTau8)
chr10: 65243388-65243447 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUUUCUUCCAAAGAGUACUCUAUGAAUCUAGUGGAAACACUUCUGCACAGGCUAGAUUAUGGAUACCAGUGUGCGGAAAUGCUUCUGCUACAUUUUUAGGGCCUGCCUACGUUUUUGGAC
Get precursor sequence
Structure
        10          20        30        40          50        
UUUUCUUCCAAAGAGUA--     U    C   UG   A  C         --| CUAGAU 
                   CUCUA GAAU UAG  GAA CA UUCUGCACA  GG      U
                   GGGAU UUUA AUC  CUU GU AAGGCGUGU  CC      A
CAGGUUUUUGCAUCCGUCC     U    C   GU   C  A         GA^ AUAGGU 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentThe Drosha site is shifted -1 relative to most other taxa.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-147_5p*

MirBase accessionNone
Sequence
0- GUGGAAACACUUCUGCACAGGCU -23
Get sequence
Mature sequence

Bta-Mir-147_3p

MirBase accessionMIMAT0009237
Sequence
38- GUGUGCGGAAAUGCUUCUGCUA -60
Get sequence
Validated targets TargetScanVert: bta-miR-147